Mark deposit $ 200 into an account that pays an interest rate 3.5% compounded annually. He doesn't add or remove from his account for 4 years how much money will markbhave in 4 years

Answers

Answer 1

Answer:

30,012.5

Step-by-step explanation:

We power the number by itself for the past years so in this it will be 3.5  powered by itself four times equaling 150.0625 multiplied by the first deposit which is 200 so 200*150.0625= 30,012.5

Hope this helps


Related Questions

What is the slope of the line represented by the equation y = 4/5x - 3

Answers

Answer:

4/5

Step-by-step explanation:

the slope is the number next to x

y=mx+b is a model we use in math to find the slope. each letter is a place marker for different numbers.

slope is where the m is in the problem

in your case 4/5 is found in the same spot as m.

What is the greatest common factor of 8 and 6

Answers

Answer: 2

Step-by-step explanation:

A box is filled with 10 bluecards, 2 red cards, and 2 yellow cards. A card is chosen at random from the box. What is the probability that the card is not red?
Write your answer as a fraction in simplest form.

Answers

Answer:

6/7 is your answer

Step-by-step explanation:

10+2+2 is 14 and that's your total number of cards. then you add the blue cards and the yellow cards to get your answer and reduce.

12/14 = 6/7

there are fourteen cards in total so that’s your denominator.
12 of the 14 cards are not red
12/14 simplify
6/7

A volunteer at the zoo is responsible for feeding the animals in 15 exhibits in the reptile house. This represents 20% of the total exhibits in the reptile house. How many exhibits are in the reptile house.

Answers

The 75 exhibits are in the reptile house.

we have given that,

A volunteer at the zoo is responsible for feeding the animals in 15 exhibits in the reptile house.

We have to determine how many exhibits are in the reptile house.

Therefore we have

if 15 exhibits = 20% of total exhibits,

What is the percentage?

A percentage is a number or ratio expressed as a fraction of 100.

then 15/20% = 75 total exhibits in the reptile house

We can check the answer,

75 x 20% = 15

Therefore the 75 exhibits are in the reptile house.

To learn more about the percentage of visits:

https://brainly.com/question/24304697

#SPJ1

i do not get this so please explain what it means

Answers

Answer:

Huh?

Step-by-step explanation:

I do not see anything.

2
Find the slope from the 2 points.
(-12,-9) and ( 18, 6)
-2
-1/2
2
1/2

Answers

Step-by-step explanation:

the slope of a line is the ratio y/x.

that means when going from one point to the other, how many units is y changing, when x changes a certain number of units.

so, going from one point to the other here, x changes by 30 units (from -12 to +18). and y changes 15 units (from -9 to 6).

therefore, the slope is

15/30 = 1/2

What is the slope of A line parallel to the line whose equation is 6x+9y=216

Answers

The slope is -2/3x hope this helped

what is an equivalent ratio to 9:1​

Answers

Answer:

 Equivalent ratio of 9:1 is 18:2.

Mark me as the brainlist

Answer:

18:2 is equivalent

pretty sure

A bag contains 3 black marbles and 5 white marbles. Paul picks a marble at random from the bag and replaces it back in the bag. He mixes the marbles in the bag and then picks another marble at random from the bag. Calculate the probability that Paul picks:
A. Two black marbles
B. Black marble in his second draw

Answers

Answer:

id go with B.

you'd get a mix because its bound to happen.

What is the slope of the line in the graph?

On a coordinate plane, a line with negative slope goes through points (0, 1) and (4, negative 2).
Negative four-thirds
Negative three-fourths
Three-fourths
Four-thirds

Answers

Answer:

the slope for (0,1)(4,-2) is -3/4

Answer:

B. Negative three-fourths

Step-by-step explanation:

PLEASE HURRY NO LINKS PLEASEEEEEE

Answers

Answer:

64

Step-by-step explanation:

-4(m-n)^2

when m=3 and n=-1

-4(3-(-1))^2=

-4(3+1)^2=

-4(4)^2=

-4(16)=-64

correct answer is -64

-4(m-n)²m=3 n=-1-4(3-(-1))²-4(3+1)²-4(4)²-4(16)-64

please mark this answer as brainlist

Solve four-tenths plus four ninths

Answers

Answer:

[tex]\frac{38}{45}[/tex]

Step-by-step explanation:

[tex]\frac{4}{10} +\frac{4}{9}[/tex]

So first you need to have a common denominator (the number on the bottom)

The least common denominator (LCD) would be 90.

So then the fractions would be: [tex]\frac{36}{90} +\frac{40}{90}[/tex].

Add.

You get: [tex]\frac{76}{90}[/tex]

Simplify and the answer is [tex]\frac{38}{45}[/tex]

what is 5.6 less than 25.3

Answers

Answer:

19.7

Step-by-step explanation:

Example # 12: The probability that Mary can work a problem is 70%.

Find the probability that Mary cannot work the problem.

HELP PLEASE!!!

Answers

Answer:

the answer is 30% hope this helps you

Answer:

30%

Step-by-step explanation:

The two outcomes (can work the problem and can't work the problem) are complementary.

In probability theory, the complement of any event A is the event [not A], i.e. the event that A does not occur. The event A and its complement [not A] are mutually exclusive and exhaustive.

Complementary events are two outcomes of an event that are the only two possible outcomes.

Complementary outcomes add to 1 or 100%.

100 - 70 = 30.

he total cost of 5 doughnuts and 6 cookies at a bakery is $11.95. The cost of each cookie is $0.95.



Select the equation and its solution that can be used to determine the cost, x, of 1 doughnut.

Answers

Answer:

x=1.25

Step-by-step explanation:

Answer:

($0.95 * 6) + (5x) = $11.95

The cost of one donut (x) = $1.25

Step-by-step explanation:

I hope this helps!

After two semesters of course work, a student has completed 32 credit hours of course work with a grade point average of 3.15. What grade point average will the
student need to complete in order to raise their cumulative grade point average to 3.2, if the student is taking 14 credit hours of graded course work this semester
(third semester)?

Answers

Using weighed average, it is found that the student will need a GPA of 3.31.

To find a weighed average, each value is multiplied by it's weight.

For the student's average, we have that:

GPA of 3.15 with a weight of 32.GPA of x with a weight of 14.

We want the mean to be 3.2, thus:

[tex]\frac{3.15(32) + 14x}{32 + 14} = 3.2[/tex]

[tex]3.15(32) + 14x = 46(3.2)[/tex]

[tex]14x = 46(3.2) - 32(3.15)[/tex]

[tex]14x = 46.4[/tex]

[tex]x = \frac{46.4}{14}[/tex]

[tex]x = 3.31[/tex]

The student will need a GPA of 3.31.

A similar problem is given at https://brainly.com/question/16233451

In a fishing derby, jimmy caught six more fish than his sister kelly. How many fish did each person catch if they caught a total of 20 fish?

Answers

That’s the answer
Hope I can help you

4. What is the interval notation for the solution set of the following number
line?
-5 -4 -3
-2
-1 0 1
2
3
4
5

Answers

Answer:

deez

Step-by-step explanation:

Use the midpoint formula to find the midpoint of (4, -2) and (6, 10)

Answers

The midpoint coordinates would be
(5,4) that is your answer

Answer:

the mid point in x axis is half of 6-4 which =1

the mid point in y axis is half of 10-(-2) which=6

hence he midpoint is (1,6)

What is the equation of this line?

y=34x−3

y=−3x−34

y=−3x−43

y=43x−3

Answers

Step-by-step explanation:

this line goes through the points (0, -3) and (4, 0).

so, the y-axis intercept is at y = -3.

therefore, the equation has to end with "- 3".

the slope (the factor of x in the equation) is the y/x ratio of the changes of y and of x when going from one point to the other :

x changes by 4 positive units (from 0 to 4), and y changes by 3 positive units (from -3 to 0).

so, the slope is 3/4.

and so, the equation is

y = (3/4)x - 3

If I`m going to solve "what is the percent is 29.00 out of of 122.50 what do I multiply by 100 or 122.50?

Answers

Answer:

I don't know the answer you know

What percent is 29 out of 122.50 is the same as, “29% of 122.50”

All you need to do is to convert 29% to decimal by moving the decimal point 2 places to the left = 0.29.

Next, multiply 0.29 by 122.50:

0.29 × 122.50 = 35.525 or 35.53 (or 36 if rounded to the nearest ones or whole number).

Please mark my answers as the Brainliest if you find this helpful :)

solve each proportion
how do you do this?

Answers

Answer:

solve each proportion

how do you do this?

Step-by-step explanation:

Help????????????????

Answers

Answer:

its gonna be b

Step-by-step explanation:

um....
.........
........​

Answers

how was your day today

Two numbers add up to 44 they have a difference of 10 what are the numbers?​

Answers

22 is half

u go down by 1 and up by 1

It ends up at 17 and 27

17+27=44

The two numbers you are looking for are 17 and 27

A total of $8000 is invested: part at 5% and the remainder at 13%. How much is invested at each rate if the annual interest is $730?

Answers

Answer:

$3875 at 5%

$4125 at 13%

Step-by-step explanation:

Let x = amount invested at 5%.

Let y = amount invested at 13%.

x + y = 8000

0.05x + 0.13y = 730

Solve the first equation for x and sustitute into the second one to solve by the substitution method.

x = 8000 - y

0.05(8000 - y) + 0.13y = 730

400 - 0.05y + 0.13y = 730

0.08y = 330

y = 4125

x = 8000 - 4125

x = 3875

Answer:

$3875 at 5%

$4125 at 13%

I am super confused about my stats homework. Every time I get the question wrong, it gives me a new set of numbers. Help!

Answers

hi! if you’re taking a quiz, from what i’ve experienced, the numbers will change every time you retake the question. this helps you to understand HOW to get the answer, rather than just memorising it. from there you just need to work out how to do the maths that’s presented to you. i hope this helps!

What is the next number in the sequence? (4, 11, 25, 53, 109, ?)

Answers

Answer:

221

Step-by-step explanation:

109×2+3=221, pattern is x2+3

--

4×2+3=11

11×2+3=25

25×2+3=53

53×2+3=109

Alex is making string bracelets for his friends he has 5 meters of string to make each bracelet. How many bracelets can Alex make?

Answers

Answer:

5

Step-by-step explanation:

Answer:

5 bracelets

Step-by-step explanation:

PLEASE MARK AS BRAINLIEST!!!!!

A politician has $4,200 to buy TV advertisements. If each advertisement costs $700, how many advertisements can the politician buy?

Answers

Answer:

He can but 6 ads

Step-by-step explanation:

how i thought of it was what times 700 hundred gives me 4,200 and i used the math that i have been taught and put together 6

Answer:

8

Step-by-step explanation:

4200÷7=

.................................

Other Questions
The text below describes the purpose of the Coalition of Independent Educator Associations (CIEA). The Coalition of Independent Educator Associations (CIEA) is made up of non-unionized education associations across America. Keeping educators connected, CIEA collaborates and focuses on serving its members in each state and on the national level. Source: cieaonline.org Judging from the organization's description, CIEA could be best categorized as what kind of interest group Life's large molecules, or macromolecules, are classified into what four categories? If I was to sketch the graph of y=4x+2What would the graph look like?Would it be a straight line or a curved line?Where would it cross the y-axis?What does 4 in 4x tell us? reasons why the alejandro o reilly (miltary leaders) ? URGENT HELP PLS I WILL MARK BRAINLIEST!!!!Ellie is cutting out a rectangular board to construct a bookshelf.The board is to have a perimeter of 84 inches, and its length is to be 3 inches shorter than double the width. describe 5 major historical events of Italy A line segment is 20 units long. The line segment is translated up 6 units and left 8 units. The length of the resulting line segment is units because translations length.The first box is 20 and the second box is preserve What is the end behavior of the graph of the polynomial function y = 10x9 4x?o As X-0, y = 0 and as X+0,7-00,o As X-0, y = 0 and as X>0, y --.As X -00, y - and as X>0, y 00XAs X-00, y -00 and as X0, y -00y Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG Can someone help me please thank you :) PLEASE HELP ME!Explain what the algebraic solution of a system of two linear equations is and what that means in terms of the graphs of the equations of the system. Use AT LEAST 2 complete sentence inyour explanation. (3 points) Choose the equation that represents the line passing through the point (2, 3) with a slope of 6. y = 6x 15 y = 6x 20 y = 6x + 15 y = 6x + 20 Why is it important to create a system flowchart before the development? How to solve this proof? What is the area? IXL assignment Triangle ABC is an isosceles triangle. Angles B and C are base angles, with measurements of (5x - 10) and (4x + 5), respectively. What is m15 35 50 60 find three consecutive integers whose sum of the first and the third is -88 What type of front is created when a warm air mass moves in to replace aretreating cold air mass? Write an equation of the line perpendicular to the given line that contains P. P(5,-3); y=1/3x+4 I cant seem to find the right answer no matter what I try