I need help with this please ​

Answers

Answer 1

Answer:

where is yr ques?????????

Answer 2

Answer:

Spanish traslation:

Necesito ayuda con esto por favor

Explanation:


Related Questions

I need help with this please​

Answers

5.Estudias
6.Viajas
7.Mira
9.practicamos

Answer:

Explanation: es - tu - diar

Palabra aguda que está formada por 3 sílabas. Se analiza el acento prosódico pronunciada con vocal tónica en la "a".

CONCLUSIÓN

La palabra estudiar, pronunciada con vocal tónica en la "a", NO lleva tilde.

Razón: Las palabras agudas no acabadas en 'n', 's' o vocal no llevan tilde.

via - jar

Palabra aguda que está formada por 2 sílabas. Se analiza el acento prosódico pronunciada con vocal tónica en la segunda "a".

CONCLUSIÓN

La palabra viajar, pronunciada con vocal tónica en la segunda "a", NO lleva tilde.

Razón: Las palabras agudas no acabadas en 'n', 's' o vocal no llevan tilde.

mi - rar

Palabra aguda que está formada por 2 sílabas. Se analiza el acento prosódico pronunciada con vocal tónica en la "a".

CONCLUSIÓN

La palabra mirar, pronunciada con vocal tónica en la "a", NO lleva tilde.

Razón:

Las palabras agudas no acabadas en 'n', 's' o vocal no llevan tilde.

ma - ne - jar

Palabra aguda que está formada por 3 sílabas. Se analiza el acento prosódico pronunciada con vocal tónica en la segunda "a".

CONCLUSIÓN

La palabra manejar, pronunciada con vocal tónica en la segunda "a", NO lleva tilde.

Razón: Las palabras agudas no acabadas en 'n', 's' o vocal no llevan tilde.

prac - ti - car

Palabra aguda que está formada por 3 sílabas. Se analiza el acento prosódico pronunciada con vocal tónica en la segunda "a".

CONCLUSIÓN

La palabra practicar, pronunciada con vocal tónica en la segunda "a", NO lleva tilde.

Razón:

Las palabras agudas no acabadas en 'n', 's' o vocal no llevan tilde.

es las costumbres y habits de una cultura que pasa entre generaciones

Answers

Answer:

If you need to translate it, it means ' it is the customs and habits of a culture that passes between generations.'

Si necesita traducirlo, significa ' son las costumbres y hábitos de una cultura que se transmite de generación en generación ».

it’s the traditions and habits in a culture that been through generations

can someone help me please??

Answers

English paper plz then maybe we can help hahaha
I hope this helps !!!!

Tu _____ en la clase de education fisica.

Answers

La respuesta es: haces ajercisio

can someone go to my question that i posted and help me with my Spanish work please I will mark you as brainliest​

Answers

Answer:

okkkk

Explanation:

I need help with this please​

Answers

Answer:

18.  el

19. hablamos

Explanation:

Answer:

18 el

19 hablamos

Explanation:

I need help with this please​

Answers

Answer:

How would you address Luz?

answer:

Explanation:

Hope it helps you..

Your welcome in a-advance..

(;ŏ﹏ŏ)(ㆁωㆁ)

Answer:

Explanation:

Tu luz

Can someone who speak Spanish help me ASAP

Answers

translated: it rains snows ice there is fog there is a storm it is cloudy it is cool it is hot it is cold it is sunny.

Explained Answers:

Winter: Snow and ice would go with winter,  Ice is hielo, snows is nieva, but when its not plural its nieve, snow, leaving only 2 areas left for winter, cold and storm could also go with winter, or cloudy, but most likely cold and storm, cold has two terms, feminine is fria, masculine is frio, except the i in the middle would have a ` on top instead of a •, and storm would be tormenta. which fills all 4 words in winter.

Summer: right off the bat the first word it words would be hot and sunny, hot is caliente, but since its in a group of other words its changed so that why you dont see caliente in the sentence, sunny has 2 terms, feminine would be soleada and masculine would be soleado, and summer has the same reason as hot for not being in the sentence, in a group of words, Now here im not completely sure what words would go with it, but the few I'm thinking of would probably be rains and cloudy, I dont completely know though, but its the closest I can think of, cloudy has 2 terms as well, feminine would be nublada, and masculine would be nublado, and rains would be lluvias, but when not plural it would be lluvia.

Spring: Much like summer, it will probably have a lot of similarities, like sunny and rains, but instead of hot I believe it would be cool and cloudy, sunny  has 2 terms, feminine would be soleada and masculine would be soleado, cloudy has 2 terms as well, feminine would be nublada, and masculine would be nublado, rains would be lluvias, but when not plural it would be lluvia, and cool would be frio, except without 2 terms and just a normal i.

Fall: fall is more or less a mix between winter and spring, having the words, cool, rains, and storm, but its own word would be fog, cool is frio with a normal i and no secondary terms, rains would be lluvias, but when not plural it would be lluvia, storm would be would be tormenta, and lastly, fog would be niebla.

thats all of the word sections and I hope this was correct and helpful. (:

Answers Summary:

Winter:

Snows: nieva

ice: hielo

cold: frio with a ` on the i

storm: tormenta

Summer:

hot: caliente

sunny: soleado

rains: lluvias

cloudy: nublado

Spring:

Sunny:soleado

rains: lluvias

cool: frio with a normal i

cloudy: nublado

Fall:

Cool: frio with a normal i

rains: lluvias

storm: tormenta

fog: niebla

thats all of the word sections and I hope this was correct and helpful. (:

Answer:

ExplanationWinter:

Snows: nieva

ice: hielo

cold: frio with a ` on the i

storm: tormenta

Summer:

hot: caliente

sunny: soleado

rains: lluvias

cloudy: nublado

Spring:

Sunny:soleado

rains: lluvias

cool: frio with a normal i

cloudy: nublado

Fall:

Cool: frio with a normal i

rains: lluvias

storm: tormenta

fog: niebla:

PLEASE HELP WITH THIS ONE QUESTION
Lee el siguiente diálogo.

NOÉ: ¡Qué bien lo pasamos andando a monopatín esta tarde! ¿Llegaste a tiempo para la función?

ESTÉBAN: No, y tuve que escuchar el concierto de pie. Ya no había asientos.

NOÉ: Yo no llegué tarde porque ya había preparado la ropa que iba a poner.

¿Qué frase está en el pluscuamperfecto?

A) había preparado

B) había asientos

C) tuve que escuchar

D) iba a poner

Answers

Answer:

A - Había preparado

Explanation:

el pretérito pluscuamperfecto Is a tense used to talk about actions in past that ended before another action

Para ______ mi viaje a San José, necesito saber antes de imre qué tipped de moneda usan y dónde me boy a quedar.

1. alquilar
2. planear
3. retrasar
4. demorar

Answers

is the second: planeaar

escride otra vez este texto pero con los verbos en pretérito perfecto

Me levanto (1) a las ocho, preparo (2) un café y me ducho (3). Salgo (4) de casa a las 8.30, tardo (5)
cuarenta minutos en llegar a la universidad; en el autobús leo (6); el autobús va (7) lleno de gente y es (8)
muy incómodo.

Estoy (9) en la facultad desde las 9.30 hasta las 14.00, pero no voy (10) a todas las clases porque estoy
(11) cansada. Después, como (12) con mi amiga Helena y más tarde tomamos (13) un café en la cafeterial
de la facultad. Vamos (14).
....... a la biblioteca y estudiamos (15)..
un rato.

Vuelvo (16) a mi casa a las 20.00; veo (17) la tele un rato, ceno (18) y juego (19) un poco con mi ordenador.

Hablo (19) por teléfono con mi novio y me acuesto (21) a las 24.00.​

Answers

Me (he levantado) a las ocho, (he preparado) un café y me (he duchado). (He salido ) de casa a las 8.30,he tardado cuarenta minutos en llegar a la universidad; en el
autobús he leído ; el autobús va (lleno) de gente y ha sido muy incómodo.
(He estado) en la facultad desde las 9.30 hasta las 14.00, pero no (he ido) a todas las clases porque (he estado) cansada. Después, (he comido) con mi amiga Helena y más tarde (hemos tomado) un café en la
cafeteria de la facultad. (Hemos ido).
a la biblioteca y (hemos estudiado ) un rato.

(he vuelto) a mi casa a las 20.00; (he visto) la tele un rato, (he cenado) y (he jugado) un poco con mi ordenador.
(He hablado) por teléfono con mi novio y me
(He acostado) a las 24.00.

I hope it helps you :)

help me plzzzzzzzzz im failing badly

Answers

Answer:

My boi gon fail dis

Explanation:

.

I need help with this please​

Answers

Answer:

Explanation:

34. comen

35. comprenden

Answer:

1. comen

2. comprenden

Explanation:

Instrucciones: Subraya el sujeto en cada oración e identifica su núcleo.
1. Es muy veloz ese deportista.
2. En América del Sur abundan las selvas ecuatoriales.
3. Cerca de la costa el barco velero naufragó.
4. Una gran piedra golpeó el cristal.
5. Dos hombres de negro dispararon sobre la víctima.
6. Ayer la llave del armario desapareció.

Answers

Answer:

1. Es muy veloz ese deportista.

2. En América del Sur abundan las selvas ecuatoriales.

3. Cerca de la costa el barco velero naufragó.

4. Una gran piedra golpeó el cristal.

5. Dos hombres de negro dispararon sobre la víctima.

6. Ayer la llave del armario desapareció.

1. That athlete is fast.

2. Equatorial forests abound in South America.

3. Near the coast the sailboat was shipwrecked.

4. A large stone hit the glass.

5. Two men in black shot at the victim.

6. Yesterday the key to the closet disappeared.

Explanation:

¿Qué opinión merece los versos" inventa mundos nuevos y cuida tu palabras, el adjetivo, cuando no da vida , mata?

Answers

Answer:

what opinion deserve the verses iventa new worlds and take care of your words the adjective when it does not give life kills

I need help with this please​

Answers

Answer:

Nosotros somos de Santiago, Chile.

Answer:

12 somos

Explanation:

help me plz im failing!!!!

Answers

Answer:

esta sirviéndose

continuamos escribiendo

sigue leyendo

siguo pensando

continuamos luchando

siguen metiéndose

están tolerando

siguen refiriéndose

continúas andado

esta saliendo

esta escribiendo

continúan lavándose

están despertándose

está vistiéndose

estan oyendo

están leyendo

esta Nadando

estamos patinando

Necesito Ayuda porfavor

Answers

Answer:

próximo

marqués

adoptó

resolución

única

tenía

allí

dedicó

cómo

producía

aún

organizó

capellán

amén

leía

periódicos

políticos

dirigía

hábilmente

agrícolas

Explanation:

Así se hace.

I need help with this please​

Answers

1. Eres

"Tú eres de Quito, Ecuador.

Translation: You are from Quito, Ecuador.

2. Eres

Ustedes eres de Lima, peru

Translation: You are from Lima, Peru

(Eres means "are" in English)

Answer:

10 eres

11 son

Explanation:

I nedd help with this please​

Answers

31) van
32) van
It’s like they go to somewhere

Answer:

1. van

2.van

Explanation:

Gina’s friend jean wrote her a letter describing her host family in Spain but she sent the wrong picture. Read the letter and write the differences between the letter and picture

Answers

what's the letter can't answer without the letter there sorry :/

i need quick help please!! giving brainliest. c:

Answers

Answer:

o, a

c,e,a,d,b

ed

ju

.ju

.ed

ju

Explanation:

hope this helps

Fill in the blank with the appropriate verb form. Mi hermana y yo____ el piano.
A. tocan
B. tocamos
C. tooas
D. toco​

Answers

The answer to the question is b

Hello Everybody :D
How was your day today?

Spanish Translation: (¿Como es el dis Todos?)​

Answers

Answer:

It's okay, and what about you?

Translate Spanish: (Estoy bien, ¿Y el tuyo?)

Solo una corrección, la traducción no es ''¿como es el dis todos?'' es realmente: ''¿Cómo esta tu día hoy?

Just a correction, the translation is not '' ¿Como es el dis Todos?'' It is really: '' ¿Cómo esta tú día hoy?''

escride otra vez este texto pero con los verbos en pretérito perfecto.

Me levanto (1) a las ocho, preparo (2) un café y me ducho (3). Salgo (4) de casa a las 8.30, tardo (5) cuarenta minutos en llegar a la universidad; en el autobús leo (6); el autobús va (7) lleno de gente y es (8) muy incómodo. Estoy (9) en la facultad desde las 9.30 hasta las 14.00, pero no voy (10) a todas las clases porque estoy (11) cansada. Después, como (12) con mi amiga Helena y más tarde tomamos (13) un café en la cafeterial de la facultad. Vamos (14). ....... a la biblioteca y estudiamos (15).. un rato. Vuelvo (16) a mi casa a las 20.00; veo (17) la tele un rato, ceno (18) y juego (19) un poco con mi ordenador. Hablo (19) por teléfono con mi novio y me acuesto (21) a las 24.00.​

Answers

Answer:

Explanation:

Me levanté (1) a las ocho, preparé (2) un café y me duché (3). Salí (4) de casa a las 8.30, tardé (5) cuarenta minutos en llegar a la universidad; en el autobús leí (6); el autobús iba (7) lleno de gente y era (8) muy incómodo. Estuve (9) en la facultad desde las 9.30 hasta las 14.00, pero no fui (10) a todas las clases porque estaba (11) cansada. Después, comí (12) con mi amiga Helena y más tarde tomamos (13) un café en la cafeterial de la facultad. Fuimos (14). ....... a la biblioteca y estudiamos (15).. un rato.

Volví (16) a mi casa a las 20.00; ví (17) la tele un rato, cené (18) y jugué (19) un poco con mi ordenador. Hablé (19) por teléfono con mi novio y me acosté (21) a las 24.00.

Marcela, es de Argentina, cocina muy bien.

Answers

Marcela is from Argentina she cooks very well.

Read and choose the option with the correct word or words to complete the sentence.

Clementine, ________ amiga de Roberto. Él no habla español y necesita amigos. Clementine, ________ conmigo a la clase de inglés; Roberto está en la clase.

sé; ven
sal; ten
sé; ten
sal; ven

Answers

the answer is së; ven

Clementine, __ sé_ amiga de Roberto. Él no habla español y necesita amigos. Clementine, _ven__ conmigo a la clase de inglés; Roberto está en la clase.

sé; ven

I need help with these please​

Answers

Answer:

TU ERESSSSSSS

ERES

Explanation:

when you are refering to 1 only people its you

tu es you

you are

tu eres de quito

Answer:

They all mean  You are from Quito, Ecuador

Explanation:

Tu eres de Quito, Ecuador is You are from Quito, Ecuador

Tu somos de Quito, Ecuador is also You are from Quito, Ecuador

Tu sois de Quito, Ecuador is also You are from Quito, Ecuador

Tu es de Quito, Ecuador is also You are from Quito, Ecuador

Hope this helps! :D

Directions: Using the right term, conjugate the senetence t make it make sense.


1) Tú (repetir/poder) las palabras del vocabulario para aprenderlas de memoria.

2) Ustedes (decir/querer) ir a la fiesta este fin de semana.

3) Ella siempre (contar/almorzar) con sus amigas en la cafetería.


4) Siempre (llover/encontrar) y hace frío en Bogotá, Colombia.

5) Yo nunca (dormir/pedir) en la clase.

6) Nosotros (repetir/pedir) ayuda cuando no entendemos la lección.

7) El camarero nos (servir/querer) nuestra comida.

8) La clase (poder/empezar) a las ocho en punto.

9) Mis amigos (preferir/dormir) ir al cine para ver películas los sábados más que los domingos.

10) Tú no (pedir/poder) sacar buenas notas si no estudias mucho para los exámenes.

Answers

Answer:

1. repetir - repeat

2. querer - want

3. almorzar - eat lunch

4. llover - raining

5. dormir - sleep, sleeping

6. pedir - ask, ask for

7. servir - serve

8. empezar - begin

9. preferir - choose

10. poder - can, I can

1) repite
2) querrán
3) almorza
4)llueve
5)duermo
6) pedimos
7) sirve
8) empieza
9)prefieren
10)puedes

SPANISH CROSSWORD: I really need some help getting this Capitulo 1A
1A- 8
crossword done! Will give points, thanks, and status!

Answers

Answer:

The pic is not good, I can’t see all.

2: contestó

15: nadie

20: llego

14: reglas

Explanation:

Other Questions
A line segment is 20 units long. The line segment is translated up 6 units and left 8 units. The length of the resulting line segment is units because translations length.The first box is 20 and the second box is preserve What is the end behavior of the graph of the polynomial function y = 10x9 4x?o As X-0, y = 0 and as X+0,7-00,o As X-0, y = 0 and as X>0, y --.As X -00, y - and as X>0, y 00XAs X-00, y -00 and as X0, y -00y Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG Can someone help me please thank you :) PLEASE HELP ME!Explain what the algebraic solution of a system of two linear equations is and what that means in terms of the graphs of the equations of the system. Use AT LEAST 2 complete sentence inyour explanation. (3 points) Choose the equation that represents the line passing through the point (2, 3) with a slope of 6. y = 6x 15 y = 6x 20 y = 6x + 15 y = 6x + 20 Why is it important to create a system flowchart before the development? How to solve this proof? What is the area? IXL assignment Triangle ABC is an isosceles triangle. Angles B and C are base angles, with measurements of (5x - 10) and (4x + 5), respectively. What is m15 35 50 60 find three consecutive integers whose sum of the first and the third is -88 What type of front is created when a warm air mass moves in to replace aretreating cold air mass? Write an equation of the line perpendicular to the given line that contains P. P(5,-3); y=1/3x+4 I cant seem to find the right answer no matter what I try what is the sum of the infinite geometric sequence 2,-1,1/2,1/4,...?with solution You have a cell, with a semi-permeablemembrane and a 1.5% potassiumconcentration. You put it into a solution of1.0% potassium. Is the solution hypertonic orhypotonic? What direction would you expectwater to flow? What do you expect to seehappen to the cell? Find the measure of each angle indicated.A) 21C) 23E) 25B) 80D) 20 100 points and brainleist to whoever gets these right Which of the following is true given that - 2/5 < 1/3 A. is to the right of 1/3 on a horizontal number line B. is at the same place as 1/3 on a horizontal number line C. is to the left of 1/3 on a horizontal number line D. is the opposite of 1/3 on a horizontal number line Mike wanted to purchase a bike for $285.00 andrealized the bike was on sale for 30% off. How muchwould Mike pay for the bike, before taxes, once thediscount was applied?A. $85.50B. $199.50C. $315.00D. $370.50please give me the right answer and ill mark you brainiest or whatever.