Mathematics High School

A group of 25 students were asked to share their favorite Ice-cream flavor. The results are shown below:
Flavor
Number of Students
Vanilla
7
Chocolate
6
Butter Pecan
5
Strawberry
4
Chocolate Chip 3
Which dot plot matches the data set?

A Group Of 25 Students Were Asked To Share Their Favorite Ice-cream Flavor. The Results Are Shown Below:FlavorNumber

Answers

Answer 1

Answer:

first 7 then 3  5  4  6

Step-by-step explanation:hope it helps

Related Questions

find the length of the hypotenuse of the right triangle. leave your answer in simplest radical form. not drawn to scale. ​

Answers

Two ways to solve this:
1) Notice that this is a 45-45-90 triangle, meaning the ratio of sides and hypotenuse is 1:1:sqrt(2)

Since the legs are 4, that would mean the hypotenuse would be 4*sqrt(2)

2) Pythagorean theorem: a^2 + b^2 = c^2

4^2 + 4^2 = 32
Sqrt(32) = 4*sqrt(2)

Answer:

it need to =90

Step-by-step explanation:

4. "Eleven subtracted from the quotient of a
number and five is -13."
How do I write this equation?? HELP

Answers

Answer:

[tex]\frac{x}{5}-11=-13[/tex]

Step-by-step explanation:

11 subtracted ( - 11 ) from the quotient ( division ) of a number ( x ) and 5 is ( = ) -13

[tex]\frac{x}{5}-11=-13[/tex]

[tex]\red{ \boxed{ \blue{ \tt{Help\:Me}}}}[/tex]​

Answers

Answer:

You go to a job and get $352.15 a day. How much would you make in a month?

Answer: 352.15 x 31= 10,916.65

Hope this helps ^^

Find the slope of the secant line for f(x) = -x^2 + 20

Answers

Answer:

250

Step-by-step explanation:

For each set of three measures, determine if they can be angle measures of a triangle.

Answers

Answer:

NO

NO

YES

NO

Step-by-step explanation:

The sum of the angles has to be equal to 180° because the sum of the angles in a triangle is 180°

The first one is already more that 180°, because you are adding 2 angles that are more than 100°

The sum of the second one is equivalent is 160°

The sum of the third one is equivalent to 180°

The sum of the fourth one is more than 180°

-Chetan K

Evaluate |15 - 15|.

O 20
O 10
O -10
O -20​

Answers

Answer:

The answer I was able to get was 0.

Which lines are parallel to y = -4x + 7?

A y-1=4(x+8)
B y=-4x+15
C 16x+4y=9
D y=-4x

Answers

Answer:

The answer is C

Step-by-step explanation:

I don't know if I'm right. Hope it helps!

ADD
3xyz + 7xyz + 9xyz

Answers

Answer:

19xyz

Step-by-step explanation:

First, let us just forget about the xyz at the end of each number. Now, we just have the simple addition problem 3 + 7 + 9. First. let us do 3 + 7, which gives us 10. Now, let us take our 10 and add the 9 to it. 10 + 9 is 19. Now, we can add our xyz back to the equation. Now, we have 19xyz. As we do not know anything about what x, y, or z equals, nothing further can be done with this equation. Therefore, the answer is 19xyz.

Hope this helps! :D

Answer: 19xyz

Step-by-step explanation:

I literally just learned this right now bc i'm in school

A rectangle's length is four-fifths its width. The
perimeter is ten less than 5 times its width.
What is the area of the rectangle?

Answers

10+5 because the perimeter is less than 5 times it’s length

-19=-14v+14v
Solve for V
:) gets brainliest

Answers

[tex]▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ { \huge \mathfrak{Answer}}▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ ▪ [/tex]

Let's solve for v :

[tex] - 19 = - 14v + 14v[/tex]

here, the the terms associated with v, that us -14v and 14v gets cancel out, so there's no solution for v and hence it's value can't be determined.

3. Tiffani has a baseball
card collection with 273
cards in it. She decides to
seil one-third of her
collection. How many cards
does she have left

Answers

Answer:

Tiffani has 182 cards left.

Step-by-step explanation:

Find one-third (1/3) of 273:

1/3 x 273 = 91

Therefore, she sells 91 cards.

273 - 91 = 182 cards left

Hope this helps :)

which shape has ten sides and angles ​

Answers

Answer:

Decagon

Step-by-step explanation:

in the picture

When Making bread from scratch the recipe calls for 3/4 cup of water if you need to make a smaller portion of the recipe how much water would you need in order to make only 1/6 of the recipe

Answers

2/6 it’s very easy search it up

Point A is located at (-3, 9) and point B is located at (12,-10). Find the distance from point A to point B rounded to the nearest tenth

Answers

Answer:

20

Step-by-step explanation:

[tex] \sqrt{(( - 10) - 9)^{2} + (12 - ( - 3)) ^{2} } [/tex]

[tex] \sqrt{( - 19)^{2} + (15)^{2} } [/tex]

[tex] \sqrt{361 + 225} [/tex]

[tex] \sqrt{586} [/tex]

[tex]24.2074[/tex]

A student wrote a photography manual which she plans to sell online for $ 13 per copy. Her total expenses were $ 55. Write a linear equation to show the relationship between x , the number of manuals the student sells, and y , the profit the student earns.

Answers

Answer:

y = 13x - 55

Step-by-step explanation:

So this is what we know

Selling price = $13 per copy

Expenses = $55

The formula for profit in this case is:

Profit = total selling price - expenses

In which y is the profit

The total selling price is 13x. x here is for the number of manuals she sells

The expenses are $55.

This then becomes y =13x - 55

HOPE THIS HELPED

Jon is training for a bike race and is attempting to improve his average speed. With his old trainer, Jon averaged a pace of 20 MPH. With his new trainer, he rode at an average speed of 22 MPH. By what percent did his average speed increase?

Answers

Answer:

Jon is now 10% faster.

Step-by-step explanation:

Since Jon's average speed was 20 MPH and his new average speed is now 22 MPH, we can see that his speed increased by 2 MPH. Now we know that, we would now do 2÷20 = .1

10% is the percent form of 0.1

The ratio of the number of cookies to the number of cupcakes in a box is 5:4. Which table shows the possible amounts of cookies and cupcakes in a box, given the ratio?

Answers

Answer:

each number in the ratio is continually multiplied by 2                                            どういたしまして(You are welcome)  :)

Step-by-step explanation:

Is this correct?
If it’s not, help me :(

Answers

if you are just plotting the points it would be;

W - (-2,-2)
X - (-2, 1)
Y - (2, 1)
Z - (4, -2)

The G.C.D and L.C.M of three numbers are 3 and 1008 respectively. If two of the numbers are 48 and 72 ,find the least possible value of the third number​

Answers

formula= LCM ×GCD of the numbers ÷ The first number

A large orange weighs 11/16 pound. A small orange weighs 2/8 pound. How much more does the large orange weigh?

Answers

Answer:

7/16 pounds

Step-by-step explanation:

Change the small orange to have the same denominator by multiplying by a magic 1 or [tex]\frac{2}{2}[/tex].

1. [tex]\frac{2}{8}[/tex]·[tex]\frac{2}{2}[/tex][tex]=\frac{4}{16}[/tex]

2. Subtract Fractions

[tex]\frac{11}{16}[/tex]-[tex]\frac{4}{16}[/tex]=[tex]\frac{7}{16}[/tex]

Free pnts, just tell me what your going get for Xmas!

Answers

Answer:

Hi and ty for being so generous!

Step-by-step explanation:

I am getting an airbrushing kit for Christmas!!

Have a great day,Youre amazing <3

Answer:

i'm getting clothes and a trip on an Alaska cruise

Step-by-step explanation:

can someone do this for me please

Answers

Answer:

Step-by-step explanation:

2(2+3) =9+1

let me know if you get it right

what is 15-10c=13 worked out

Answers

Answer:

[tex]15 - 10c = 13 \\ 10c = 15 - 13 \\ 10c = 2 \\ c = \frac{2}{10} \\ c = \frac{1}{5} [/tex]

How are SSS and SAS similarity theorems different from one another? *

Answers

Answer:

when two triangles are said to be similar by SSS theorem, these 2 triangles not only have 3similar sides, but also the same 3 angles. on the other hand if they're said to be similar SAS theorem, it's highly unlikely they will have all three same Angles.

hope this helped

GIVING RITHT ANSWER BRANLEIST ABCDEF

Answers

Answer: its the 4th question

Step-by-step explanation: Its 64 squared because 8x8 is 64 its a perfect square

(3.7×10^8)–(1.76×10^8)

Answers

Answer:

194000000

Step-by-step explanation:

Hey there!

(3.7 × 10⁸) - (1.76 × 10⁸)

= (3.7 × 100000000) - (1.76 × 100000000)

= 370000000 - 17600000

= 194000000.

Hope it helps ya!

what two numbers have a sum of 4 and product of 12

Answers

The numbers are 6 and -2.
6 + -2 is 4
as well as 6 x -2 is -12

Answer:

6 and 2 this is the answer my child.

Will mark 50 points for whoever answers correctly !

Answers

Answer:

Correctly !

Step-by-step explanation:


Michaela gets paid $12.45 per hour. If she works 5.5. hours, how much will she earn?

Answers

Answer:

68.48

Step-by-step explanation:

12.45*5.5=68.48

If a=7 and b=2 what is 2a+3b ?

Answers

Answer:

20

Step-by-step explanation:

You basically just plug in the numbers given for the variables and solve.

2(7)+3(2) = 14+6= 20

You substitute 7 in for a and 2 in for b.
Other Questions
describe 5 major historical events of Italy A line segment is 20 units long. The line segment is translated up 6 units and left 8 units. The length of the resulting line segment is units because translations length.The first box is 20 and the second box is preserve What is the end behavior of the graph of the polynomial function y = 10x9 4x?o As X-0, y = 0 and as X+0,7-00,o As X-0, y = 0 and as X>0, y --.As X -00, y - and as X>0, y 00XAs X-00, y -00 and as X0, y -00y Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG Can someone help me please thank you :) PLEASE HELP ME!Explain what the algebraic solution of a system of two linear equations is and what that means in terms of the graphs of the equations of the system. Use AT LEAST 2 complete sentence inyour explanation. (3 points) Choose the equation that represents the line passing through the point (2, 3) with a slope of 6. y = 6x 15 y = 6x 20 y = 6x + 15 y = 6x + 20 Why is it important to create a system flowchart before the development? How to solve this proof? What is the area? IXL assignment Triangle ABC is an isosceles triangle. Angles B and C are base angles, with measurements of (5x - 10) and (4x + 5), respectively. What is m15 35 50 60 find three consecutive integers whose sum of the first and the third is -88 What type of front is created when a warm air mass moves in to replace aretreating cold air mass? Write an equation of the line perpendicular to the given line that contains P. P(5,-3); y=1/3x+4 I cant seem to find the right answer no matter what I try what is the sum of the infinite geometric sequence 2,-1,1/2,1/4,...?with solution You have a cell, with a semi-permeablemembrane and a 1.5% potassiumconcentration. You put it into a solution of1.0% potassium. Is the solution hypertonic orhypotonic? What direction would you expectwater to flow? What do you expect to seehappen to the cell? Find the measure of each angle indicated.A) 21C) 23E) 25B) 80D) 20 100 points and brainleist to whoever gets these right Which of the following is true given that - 2/5 < 1/3 A. is to the right of 1/3 on a horizontal number line B. is at the same place as 1/3 on a horizontal number line C. is to the left of 1/3 on a horizontal number line D. is the opposite of 1/3 on a horizontal number line