what part of the cell cycle represents cell division?
PLEASE HELP

Answers

Answer 1

Answer: The mitotic phase.

Explanation:

The replicated DNA and cytoplasmic contents are separated, and the cell divides.

Answer 2

Explanation:

cell cycle is divided into two phases called as

1)interphase

2)Mphase

interphase= a period of preparation of cell division.

Mphase= the actual period of cell division.

hope it helped you......


Related Questions

Astrology is pseudoscience. What can you conclude about the claims made by astrology? A. They are based off of critical thinking. B. They are based on unscientific methods. C. They are based on repeated evaluation. D. They are based on logical reasoning.

Answers

Answer:

B

Explanation:

Astrology has not demonstrated its effectiveness in controlled studies and has no scientific validity.

Cellular respiration in plants does not require atmospheric oxygen because

Answers

Answer:

Oxygen produced during light reaction of photosynthesis is partially consumed during cellular respiration by plants and unconsumed oxygen is released in atmosphere. Thus plants produce oxygen in presence of light.

Answer:

it uses the oxygen generated in photosynethesis

Explanation:

How does pH affect plant growth?

Answers

Answer:

Soil pH directly affects the life and growth of plants because it affects the availability of all plant nutrients. Between pH 6.0 and 6.5, most plant nutrients are in their most available state. A nutrient must be soluble and remain soluble long enough to successfully travel through the soil solution into the roots.

A. Identify what parameters are not within normal ranges.

Answers

Answer:

A normal range is the restricted set of values that is optimally healthful and stable.

A reference range is usually defined as the set of values 95 percent of the normal population falls within (that is, 95% prediction interval). It is determined by collecting data from vast numbers of laboratory tests.

A covalent bond forms due to _____.

a. Sharing of electrons

b. Transfer of electrons

c. Losing or gaining electrons

d. All of the above

Answers

C l hope it's right : )

the thick mucus secreted by the tissues lining the respiratory passages is known as

Answers

It is known as the phlegm

Please help me
will give the brainliest!
Please answer correctly​

Answers

A
Chain 1: oak trees —> moths —> small birds —> weasels

Chain 2: trees and bushes —> moths —> shrews


B
Voles


C
Since part of shrews’ alimentation are beetles and beetles sometimes eat earthworms, which eat dead leaves, a reduction of the dead leaves will reduce de population of shrews as their food will no longer be as abundant.


D
Level y is small on the first diagram because one organism feeds multiple other ones, while on the other diagram, multiple organisms feed other ones.

Hope it helps !

What the relationship between a glucose molecule and the products it makes during cellular respiration.

Answers

Answer:

During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water. Along the way, some ATP is produced directly in the reactions that transform glucose. Much more ATP, however, is produced later in a process called oxidative phosphorylation.

During cellular respiration, glucose makes water, carbon dioxide, ATP, lactic acid, and ethanol. In the absence of oxygen, ethanol and lactic acid are formed from the glucose.

What is glycolysis?

 

Glycolysis is a process in which glucose breaks down inside a cell. Glucose makes pyruvate as an end product in this process. In the presence of oxygen, glucose breaks down into pyruvate and proceeds to the Krebs cycle. In this process, ATP, water, and carbon dioxide are released.

In the absence of oxygen, glucose is converted into lactic acid and ethanol. This is called fermentation and produces only 2 ATP from glucose. This is called anaerobic respiration.

         

When oxygen is present from glucose, nearly 36-38 ATP are formed. Pyruvate converts into acetyl CoA, and it enters the Krebs cycle. A complete oxidation of glucose takes place in the presence of oxygen.

Hence, in the presence of oxygen, 36-38 ATP is released from glucose, and in the absence of oxygen, lactic acid and ethanol are produced with 2 ATP.

To learn more about glycolysis, refer to the following link:

https://brainly.com/question/15159050

 

#SPJ2

Which of the following is correct?
Insulin is a protein, and the monomers of
proteins are fatty acids.
Insulin is a protein, and the monomers of
proteins are nucleotides
Insulin is a protein and the monomers of
proteins are glucose,
Insulin is a protein and the monomers of
proteins are amino acid

Answers

Answer:

Insulin is a protein and the monomers of

proteins are amino acid

Explanation:

please solve fast in 5 min​

Answers

Answer:

(C)

Explanation:

answer"A" can be cancelled as prokaryotic cells don't possess a nucleus.

answer"B" can be cancelled as animal cells don't have cell walls.

answer"D" can be cancelled if you know the cell theory.

what is the difference between sister chromatids and homologous chromosomes?

Answers

Answer:

A sister chromatid refers to the identical copies (chromatids) formed by DNA replication of a chromosome, with both copies joined by a common centromere.

Explanation:

Homologous chromosomes may or may not be the same as each other because they are derived from different parents.

where in eukaryotic cells does the calvin cycle take place?

Answers

Answer:

chloroplasts

The two parts of photosynthesis—the light-dependent reactions and the Calvin cycle—have been described, as they take place in chloroplasts.

Explanation:

Which of these claims is true of Venus?


A. Venus has two moons.

B. On Venus, a day is longer than a year.

C. Venus is the fourth planet from the sun.

D. The atmosphere of Venus is capable of supporting life.

Answers

Answer:

B.) On Venus, a day is longer than a year, is the answer to your question. I hope this helps.

Answer:

b

Explanation:

took the test

what happens when air masses of different temperatures meet?

Answers

Answer: When two air masses meet together, the boundary between the two is called a weather front. At a front, the two air masses have different densities, based on temperature, and do not easily mix. ... Winds are common at a front. The greater the temperature difference between the two air masses, the stronger the winds will be.

Explanation:

__________________________ a. A laboratory in a major university surveys all the reactions involving bromine. __________________________ b. A pharmaceutical company explores a disease in order to produce a better medicine. __________________________ c. A scientist investigates the cause of the ozone hole to find a way to stop the loss of the ozone layer. __________________________ d. A pharmaceutical company discovers a more efficient method of producing a drug. __________________________ e. A chemical company develops a new biodegradable plastic. __________________________ f. A laboratory explores the use of ozone to inactivate bacteria in a drinkingwater system.

Answers

Basic research generates basic knowledge. Applied research solves practical problems. Technological development provides tools and artifacts for research. A: basic research. B, C, F: applied knowdelge. B, D, E: technological development.

----------------------------------------

Let us first review some framework.

Basic research is directed to understand fundamental problems or issues. It is about generating basic knowledge. It constitutes the theoretical basis of knowledge on which applied science or technology is based.

Applied research makes use of the knowledge generated by basic science to solve practical problems. It generates knowledge that has practical use.

Technological development is one of the main tools of science. Its main function is to create useful tools and artifacts to facilitate the scientist's work.

Now let us classify each item.

a. A laboratory in a major university surveys all the reactions involving bromine. BASIC RESEARCH

b. A pharmaceutical company explores a disease in order to produce a better medicine. APPLIED RESEARCH and TECHNOLOGICAL DEVELOPMENT

c. A scientist investigates the cause of the ozone hole to find a way to stop the loss of the ozone layer. APPLIED RESEARCH

d. A pharmaceutical company discovers a more efficient method of producing a drug. TECHNOLOGICAL DEVELOPMENT

e. A chemical company develops a new biodegradable plastic. TECHNOLOGICAL DEVELOPMENT

f. A laboratory explores the use of ozone to inactivate bacteria in a drinkingwater system. APPLIED RESEARCH

--------------------------------------------------------

Related link: https://brainly.com/question/24183440?referrer=searchResults

How are a hypothesis and a theory similar?

Answers

Answer:

A hypothesis is either a suggested explanation for an observable phenomenon, or a reasoned prediction of a possible causal correlation among multiple phenomena. In science, a theory is a tested, well-substantiated, unifying explanation for a set of verified, proven factors.

PLEASE HELP ASAP!!
Adjust the length. How does the length of a pendulum affect its period?

Answers

Answer:

The longer the length of string, the farther the pendulum falls and therefore, the longer the period

Explanation:

Why is the sequence of amino acids important to protein function?

Multiple choice question.

A)
The sequence of amino acids doesn't have an effect.

B)
The order of amino acids determines the shape a protein will take.

C)
The order of the amino acids can be read like a code to assemble DNA.

D)
Amino acids can only be combined in a specific order, otherwise the bonds will fall apart.

Answers

Answer:

b

Explanation:

mutations in an amino acid sequence affect the function of its protein

viruses are not considered living organisms because they are not composed of:

Answers

Answer:

Viruses are not living things. Viruses are complicated assemblies of molecules, including proteins, nucleic acids, lipids, and carbohydrates, but on their own they can do nothing until they enter a living cell. Without cells, viruses would not be able to multiply. Therefore, viruses are not living things

Explanation:

Answer:Viruses are not living things. Viruses are complicated assemblies of molecules, including proteins, nucleic acids, lipids, and carbohydrates, but on their own they can do nothing until they enter a living cell. Without cells, viruses would not be able to multiply. Therefore, viruses are not living things.

The tail of a comet always points towards the sun true or false​

Answers

False , it will always point away because the radiation pressure of the sunlight

to stimulate muscle contraction acetylcholine is released from the

Answers

Answer:

motor neuron

Explanation:

The movement of water across a cell membrane that does not require
energy is called what?

Answers

The movement across a cell membrane that Dosent contain energy is known as discussion
osmosis
Diffusion: the Simple and the Facilitated
We call this evening-out moving “downhill”, and it doesn't require energy. The molecule most likely to be involved in simple diffusion is water - it can easily pass through cell membranes. When water undergoes simple diffusion, it is known as osmosis.

Which statement describes a positive effect of selective breeding?

Answers

Answer:

desirable traits are passed down into future generations

Explanation:

which part of the bone is a hollow cylinder that makes the bone strong

Answers

Explanation: diaphysis

how is a microscopes total magnification calculated

Answers

Answer:

rtr greggryrwufwffvtyfjggakakakakakrfckvwtnhurtehjnsgberwghebhj

Explanation:

after telophase i of meiosis, the chromosomal makeup of each daughter cell is

Answers

Answer:

haploid, and the chromosomes are each composed of two chromatids

Explanation:

going off what I remember

Which two statements describe force?
A. Force causes an object's motion to remain constant.
B. A force can have mass or weight.
C. Force is the ability to change an object's motion.
D. A force can be a push or a pull.

Answers

Answer:

D. a force can be a push or a pull and A.

hazards to humans that come into contact with it,
4. Study the graphs in the stimulus. Order the events that occurred at the Bodega Bay study
site, where scientists used traps to catch and count samples of marine organisms, from
1to 5. Write a 1 by the first event to occur and a 5 by the last event.
5 The number of native clams per sample falls from 100 to 10.
1 Scientists find European Green Crabs in Bodega Bay.
4 Scientists find that the number of native clams per sample has risen to 40.
3 The number of native shore crabs per sample falls from 25 to 20.
2 The number of European Green Crabs per sample falls from 5 to 4.

Answers

Number 1 to 5 which would be that then answer

the red blood cells and brain are two body tissues that derive most of their energy from

Answers

[tex] \huge \mathfrak{{ \pmb{ \underline{ \red{Answer}}}}}[/tex]

The red blood cells and brain are two body tissues that derive most of their energy from glucose.

Glucose is the answer.

The red blood cells and brain are two body tissues that derive most of their energy from carbohydrates. The correct option is C.

What are carbohydrates?

Sugar molecules make up carbohydrates, or carbs. Carbohydrates are one of the three primary nutrients included in foods and beverages, along with proteins and fats.

Glucose is created by your body's breakdown of carbs. The primary source of energy for the cells, tissues, and organs in your body is glucose, sometimes known as blood sugar.

Under normal conditions, glucose serves as the brain's main energy source.

Using either glycolysis or oxidative phosphorylation—the latter of which is 15 times more efficient—glucose is used to create energy in the form of adenosine triphosphate (ATP).

In the absence of glucose, the brain has backup energy sources, such as ketones created by fatty acid metabolism, which predominantly takes place in the liver.

These include 3-hydroxybutyrate, acetone, and acetoacetate (3BHM).

Thus, the correct option is C.

For more details regarding carbohydrates, visit:

https://brainly.com/question/29775112

#SPJ6

Your question seems incomplete, the missing options are:

fat

protein.

carbohydrate.

iron.

¿De qué manera comprobarías el funcionamiento del filtrador de agua?

Answers

Answer:

La forma más eficaz de determinar si su filtro de agua funciona correctamente es analizar el agua antes y después de que pase por el filtro.

Other Questions
Leah has a points card for a movie theater. She receives 30 rewards points just for signing up. She earns 2.5 points for each visit to the movie theater. She needs 50 points for a free movie ticket. Write and solve an equation which can be used to determine v, the number of visits Leah must make to earn a free movie ticket. The text below describes the purpose of the Coalition of Independent Educator Associations (CIEA). The Coalition of Independent Educator Associations (CIEA) is made up of non-unionized education associations across America. Keeping educators connected, CIEA collaborates and focuses on serving its members in each state and on the national level. Source: cieaonline.org Judging from the organization's description, CIEA could be best categorized as what kind of interest group Life's large molecules, or macromolecules, are classified into what four categories? If I was to sketch the graph of y=4x+2What would the graph look like?Would it be a straight line or a curved line?Where would it cross the y-axis?What does 4 in 4x tell us? reasons why the alejandro o reilly (miltary leaders) ? URGENT HELP PLS I WILL MARK BRAINLIEST!!!!Ellie is cutting out a rectangular board to construct a bookshelf.The board is to have a perimeter of 84 inches, and its length is to be 3 inches shorter than double the width. describe 5 major historical events of Italy A line segment is 20 units long. The line segment is translated up 6 units and left 8 units. The length of the resulting line segment is units because translations length.The first box is 20 and the second box is preserve What is the end behavior of the graph of the polynomial function y = 10x9 4x?o As X-0, y = 0 and as X+0,7-00,o As X-0, y = 0 and as X>0, y --.As X -00, y - and as X>0, y 00XAs X-00, y -00 and as X0, y -00y Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG Can someone help me please thank you :) PLEASE HELP ME!Explain what the algebraic solution of a system of two linear equations is and what that means in terms of the graphs of the equations of the system. Use AT LEAST 2 complete sentence inyour explanation. (3 points) Choose the equation that represents the line passing through the point (2, 3) with a slope of 6. y = 6x 15 y = 6x 20 y = 6x + 15 y = 6x + 20 Why is it important to create a system flowchart before the development? How to solve this proof? What is the area? IXL assignment Triangle ABC is an isosceles triangle. Angles B and C are base angles, with measurements of (5x - 10) and (4x + 5), respectively. What is m15 35 50 60 find three consecutive integers whose sum of the first and the third is -88 What type of front is created when a warm air mass moves in to replace aretreating cold air mass? Write an equation of the line perpendicular to the given line that contains P. P(5,-3); y=1/3x+4