ayoooo! hi hey, whats yur favorie show

Answers

Answer 1

I personally like The Dragon Price (a Netflix original series) and The Pink Corruption (a Just Shapes & Beats fan-animation series), but the creators of The Pink Corruption have done some very bad things and should not be supported any further than viewing their content.

Answer 2

I like to watch Pokemon :)


Related Questions

How did the Great Awakening help to shape a spirit of independence in the colonies?

Answers

Answer:

The Great Awakening contributed to the development of an “independent spirit” among American colonists because it reduced the power of hierarchical religious sects. It contributed, instead, to a situation in which people thought more for themselves about issues of religion.

Explanation:

The Great Awakening contributed to the development of an “independent spirit” among American colonists because it reduced the power of hierarchical religious sects. It contributed, instead, to a situation in which people thought more for themselves about issues of religion.

Do you guys think having an 84 grade is good.
and do you guys think having a 74 is good?

Answers

Answer:

I think both are good but 84 is better

PLEASE HELP ME!!!!!

We, the people of the Choctaw Nation, having a right to establish our own form of Government, not inconsistent with the Constitution, Treaties and Laws of the United States: by our Representatives, assembled in Convention at Nanihwaiya on Thursday the tenth day of November, 1842, in order to establish Justice, insure Tranquility, promote the general Welfare, and secure to ourselves and our Posterity the right of Life, Liberty and Property: We mutually agree with each other to form for ourselves a free and independent Government.

And we do hereby recognize the boundaries assigned the Choctaw Nation by the second article of the treaty made and concluded with the United States of America at Dancing Rabbit Creek on the 27th day of September 1830: viz. beginning near Fort Smith where the Arkansas boundary crosses the Arkansas River, running thence to the source of the Canadian Fork, if in the limits of the United States, or to those limits, thence due South to Red River, thence down Red River to the western boundary of the State of Arkansas, thence North along that line to the beginning: the boundary of the same to be agreeable to the Treaty made and concluded at Washington City in the year 1825.

What is the main purpose of the preamble of the 1842 Choctaw Constitution?

Answers

Answer:

The Declaration of Independence was designed for multiple audiences: the King, the colonists, and the world. It was also designed to multitask. Its goals were to rally the troops, win foreign allies, and to announce the creation of a new country. The introductory sentence states the Declaration’s main purpose, to explain the colonists’ right to revolution. In other words, “to declare the causes which impel them to the separation.” Congress had to prove the legitimacy of its cause. It had just defied the most powerful nation on Earth. It needed to motivate foreign allies to join the fight.

Which actions directly contributed to the United States entering World War I? Select two options.

Germany sank US ships.
Germany expanded its colonial empire.
Germany sent the Zimmermann Telegram.
Germany attacked US territory.
Germany signed a treaty with Austria-Hungary.

Answers

Answer:

I think they sank US ships and attacked US territory

Answer:

A. Germany sank US ships.

D. Germany attacked US territory.

Explanation:

Rigth on Edge

summarize the american revolution in 5-10 words. boil it down to its bare essentials.

Answers

The American Revolution slowly grew and action broke out and the colonies won.

how did Toussaint respond to October 29, 1801?

Answers

In March 1801, Louverture appointed a constitutional assembly, composed chiefly of white planters, to draft a constitution for Saint-Domingue. He promulgated the Constitution on 7 July 1801, officially establishing his authority over the entire island of Hispaniola.

Answer:

He tried to negotiate.

Explanation:

PLEASE MARK WITH BRAINLIEST!!!!!

All of the following are true regarding the economic hardships on farmers EXCEPT:
a.
crop prices increased
c.
they faced interest rates of more than 10 percent per year
b.
crop prices fell
d.
they had plagues of grasshoppers and boll weevils


Please select the best answer from the choices provided

Answers

Answer:

Crop prices fell is not true because during that time and how money works crop prices rose up due to less and less crops making it hard to make something out of a thing slowly decreasing in quantity for the same price

Drag each label to the correct location.
Determine whether the following characteristics describe conditions in Germany before or after unification.
written constitution
300 German states
trade facilitated
in the region
risk of French aggression

Answers

C I took the test I took the test hahaha

What are three long term causes of colonial resistance to British policies
Will give brainliest to whoever answers this correctly

Answers

Answer:

Britain's debt from the French and Indian War led it to try to consolidate control over its colonies and raise revenue through direct taxation (e.g., Stamp Act, Townshend Acts, Tea Act, and Intolerable Acts), generating tensions between Great Britain and its North American colonies.

Why did Washington order trenches dug?

Answers

Answer: To allow the movement of larger artillery toward the British fortifications

Explanation: I hope this helps :) you've got this!

Answer:

To move artillery.

Explanation:

Washington had trenches dug to help move the artillery(heavy weapons) closer.

What is slash-and-burn agriculture?

Answers

Explanation:

Slash-and-burn agriculture is a farming method that involves the cutting and burning of plants in a forest or woodland to create a field called a swidden. The method begins by cutting down the trees and woody plants in an area

03.02 recipe for America ​

Answers

Answer:

Explanation:

Group that contributed to American society and culture.One significant contribution from this group on American society and/or culture.Explain how the contribution aAmerican society and/or cultur– What did Americans gain fromcontribution?)Native AmericansJewelry making was a contribution.Jewelry became an accessory for fashion.African AmericansMusic was a contribution.Music is everywhere in today’s society and culture.WomenRaising children was a contribution.Mom care for their children.ChildrenHelping the family making clothes and farming.The girls help with household chores and the boys help with yawork and heavy chores.

how did the boundary created by the proclamation of 1763 affect the colonists?

Answers

Answer:

After Britain won the Seven Years' War and gained land in North America, it issued the Royal Proclamation of 1763, which prohibited American colonists from settling west of Appalachia. The Treaty of Paris, which marked the end of the French and Indian War, granted Britain a great deal of valuable North American land.

Explanation:

how frequently do you think lynchings took place, based on this quote?

Answers

Answer:

one a week or one a day it couldnt be any less unless they were "joking "

Laws are created to ensure that citizens...
A. get the best tax rates every year
B. do not hurt people or property
C. protect only the state's natural resources
D. get a good education

Answers

b. do not hurt people or property!

take note of the important numbers and information regarding who approach for their needs ​

Answers

Answer:

can anyone help me in computer

Which restriction on the presidency was instituted by the passage of the 22nd Amendment?


The President is not allowed to start a new term until March 3rd.


The president can only serve 2 terms or a total of 10 years.


The President is not allowed to appoint justices to the Supreme Court


Congress, not the president, must pick a Vice President if there is a vacancy in the office.

Answers

Answer:

The president can only serve 2 terms or a total of 10 years.

Explanation:

This was passed after President Franklin D. Roosevelt served his fourth term in office for a total of 16 years as the president.

What should be considered about the roles of women in feudal Japan to understand the context of The Pillow Book?

Women had the same rights as men.
Women had limited opportunities to work.
Women could only be married or live with their parents.
Women had the same educational opportunities as men.

Answers

Answer:

B - women had limited opportunities to work

Explanation:

Answer:I honestly don’t think ur pretty I know ur pretty and looks don’t matter it’s about the personality and hart.

Explanation:

PLEASE HELP!!!

A. Ordered the end of slavery
B. Gave women more social power
C. Was one of the first written codes of law
D. Set up a unified religion

So I know that it's not A or B but I'm a little confused with C and D. Cause the Code of Hammurabi was written by the King Hammurabi and he said that the Sun god told him those laws. But then history says that the Code of Hammurabi was based on an older set of laws (written by Ur-Nammu) bu the point it I need help because I'm already sorta close to failing this World History class..............???????????????????????????????

Answers

Answer:

c is the answer I took the test

list the health experiences you can learn from your family members.​

Answers

Answer:

Consider what you've inherited from your parents. On the outside, you might point to hair color, height, and weight. What about on the inside? Have your parents dealt with high blood pressure, high cholesterol, or diabetes? What about their parents?

Based on the health history of your first-, second-, and third-degree relatives, you may be able to predict what your own future health has in store. The same goes for any children you may have. These tips for keeping track of your family medical history will explain why recording and preserving certain medical information is so important.

All in the Family

Chronic diseases that occur in at least two of the following sets of relatives are more likely to affect you. First-degree relatives are those with whom you share 50 percent of your genes: your parents, siblings, and children. Second-degree relatives are the siblings of your parents: your aunts and uncles. Third-degree relatives are their children: your first cousins.

The conditions that most often run in families are diabetes, coronary heart disease, and cancer. Having one family member with one of these means that you should consider yourself at increased risk. There are a few pieces of information that you should check out concerning your family members:

At what age did the chronic illness first become an issue for the relative?

For those who have passed away, what was the cause?

At what age did your first-, second- and third-degree relatives pass away?

Genetically linked diseases tend to occur earlier in life. They are also often more severe. If two generations of your family had heart attacks before the age of 40, then you, your siblings, and possibly your children are at significantly increased risk of having similar issues at around the same time in life. If one cousin had cancer later in life, survived, and eventually died of something else, then it is somewhat less likely that the cancer is genetic.

Genetics Aren't Everything

Environment and lifestyle also play significant roles in your health. Knowing that you have diabetes and hypertension in your family means that you should choose to stay away from certain foods and exercise frequently. Healthy choices such as these can greatly affect if and when diabetes, heart disease, and sometimes cancer develop.

Recording Family Health

When you keep close track of your family's medical history, it allows health care providers to look into diagnoses that they might not otherwise consider, to screen for genetic conditions, to order the right tests, and to recommend the best way for you to take care of your health. When you meet a new service provider, they will ask you about the health of your first-, second-, and third-degree relatives. My Family Health Portrait, a free tool from the Office of the Surgeon General, is a quick and accurate way to create a family medical history. Bring this history to your medical appointments, along with your other health records, to make each appointment more productive and to make you and your doctor a more effective, communicative team.

Explanation:


When a group of citizens assemble at a public meeting to discuss government policies, they are protected in their right to
assemble by the

Answers

Answer:

the freedom of speech and the right to peaceably assemble.

Explanation:

How was life different in the 1918"s for Women and Men in this time period

Answers

Answer:

How the flu helped change people's minds. Increased participation in the workforce allowed many women to obtain social and financial independence.

Explanation:

I think that's right

Which of the following statements best describes the massacre at Sand Creek in 1864?
O Many of the American Indians who were killed were women and children.
O The massacre was a battle between Cheyenne warriors and gold miners.
O About 80 federal troops were attacked by Red Cloud's warriors.
O The Dakota staged an uprising after the government failed to provide for them.

Answers

Answer:

Many of the American Indians who were killed were women and children

Answer:

A

Explanation:

Which phrase best completes the partial outline below?
I. Achievements of the Incas
A. _____________________________
B. Kept records using quipus
C. Built stone structures without using mortar

a. Cast bronze statues c. invented a foot stirrup
b. created a system of terraced
farming
a. Cast bronze statue b. created a system of terraced farming
c. invented a foot stirrup d. developed chariots

Answers

b; created a system of terraced farming was one of their great achievements

Answer: The major achievement of the Incas were their system of roads and bridges, centralized economy, social harmony, medicine, fortifications and buildings, accounting system, aqueducts and agricultural terraces

Explanation:

Question 2 (2 points)
How big was the asteroid that hit the Earth?
700 feet wide
70 feet wide
7 miles wide

Answers

Answer:

I think it 70

Explanation:

Answer: not sure

Explanation: because I don't know

which president is the only one to serve two non-consecutive terms?

Answers

Answer:

El presidente y vicepresidente duran en sus funciones el termino de cuatro años y podrán ser reelegidos o sucederse recíprocamente por un solo periodo consecutivo. Si han sido reelectos o se han sucedido recíprocamente no pueden ser elegidos para ninguno de ambos cargos, sino con el intervalo de un periodo.

what geographic advantage did the continental army have?

Answers

Answer:    From the rocky terrain of the north, humid swamplands of the south and dense forests of the west, the Continental Army's superior knowledge of the varied geography gave them an incredible advantage. As such, mapping was critical to the colonists' victory

Explanation:

describe the kind of activities that would be done in the process of beautifying your community​

Answers

eyelahes eyeliner eyehshadow

the relationship between Haiti’s political instability and the natural disasters it has faced?

Answers

Answer:

The president of Haiti had recently been assassinated. Also, earthquakes have been demolishing Haiti. This has caused Haitians to migrate away from Haiti, and into America.

Explanation:

which statement describes how the transcontinental railroad affected the united states during the late 1800s?

Answers

an expansion of settlement and growth in the western towns

Other Questions
Indicate what kind of ambiguity is expressed by the following utterance. Provide two paraphraseswhich are not ambiguous for the utterance below.This will make you hot. Leah has a points card for a movie theater. She receives 30 rewards points just for signing up. She earns 2.5 points for each visit to the movie theater. She needs 50 points for a free movie ticket. Write and solve an equation which can be used to determine v, the number of visits Leah must make to earn a free movie ticket. The text below describes the purpose of the Coalition of Independent Educator Associations (CIEA). The Coalition of Independent Educator Associations (CIEA) is made up of non-unionized education associations across America. Keeping educators connected, CIEA collaborates and focuses on serving its members in each state and on the national level. Source: cieaonline.org Judging from the organization's description, CIEA could be best categorized as what kind of interest group Life's large molecules, or macromolecules, are classified into what four categories? If I was to sketch the graph of y=4x+2What would the graph look like?Would it be a straight line or a curved line?Where would it cross the y-axis?What does 4 in 4x tell us? reasons why the alejandro o reilly (miltary leaders) ? URGENT HELP PLS I WILL MARK BRAINLIEST!!!!Ellie is cutting out a rectangular board to construct a bookshelf.The board is to have a perimeter of 84 inches, and its length is to be 3 inches shorter than double the width. describe 5 major historical events of Italy A line segment is 20 units long. The line segment is translated up 6 units and left 8 units. The length of the resulting line segment is units because translations length.The first box is 20 and the second box is preserve What is the end behavior of the graph of the polynomial function y = 10x9 4x?o As X-0, y = 0 and as X+0,7-00,o As X-0, y = 0 and as X>0, y --.As X -00, y - and as X>0, y 00XAs X-00, y -00 and as X0, y -00y Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG Can someone help me please thank you :) PLEASE HELP ME!Explain what the algebraic solution of a system of two linear equations is and what that means in terms of the graphs of the equations of the system. Use AT LEAST 2 complete sentence inyour explanation. (3 points) Choose the equation that represents the line passing through the point (2, 3) with a slope of 6. y = 6x 15 y = 6x 20 y = 6x + 15 y = 6x + 20 Why is it important to create a system flowchart before the development? How to solve this proof? What is the area? IXL assignment Triangle ABC is an isosceles triangle. Angles B and C are base angles, with measurements of (5x - 10) and (4x + 5), respectively. What is m15 35 50 60 find three consecutive integers whose sum of the first and the third is -88 What type of front is created when a warm air mass moves in to replace aretreating cold air mass?